TABLE 3

Primers for RT-qPCR

Gene nameNucleotide sequence (5′ to 3′)
β-ActinForward TCACCAACTGGGACGACA
Reverse GCATACAGGGACAGCACA
CKAP4Forward CCTGCTGGACAGACTCTCCTCTC
Reverse GGCGGACTCCAAGTTGTTCTCG
DNAJB1Forward CACCGAAGAACTCAGCAAAC
Reverse ACCACCCGGACAAGAACA
DNAJA1Forward TTCTACCTGGTCCATTTC
Reverse CAACCGAACCATAGTCAT
HSPH1Forward AACTCAACATTCACCACC
Reverse TATCCAGCAAGACAACAA
HSPA8Forward GGATGACACCTCCTCTGG
Reverse CGCCTTTACTGATACCGA
PPP1R15AForward GAGGTGGGAGCCTACAGA
Reverse GGTGGAGGTAACGAAGTGA
FOSL1Forward CACAGGCCAGCAGAAGTTCCAC
Reverse TGAGGTTGAACCATCCACTGAAGC
JUNForward TGCCCGTTGCTGGACTGTAT
Reverse ACGACCTTCTACGACGATGCC
IL17RAForward TTCTGGATTGGTGGTTTGG
Reverse TGCCTTCAGCCACTTCGT
FOSBForward CCCAGCCTTGACCGTAGAT
Reverse CGAGAAGTTTGCCGAGTGA
CD74Forward CAGCCCAGATGACGGATA
Reverse AGCCCAACTGCGACGAGA