TABLE 4

2-Step protocol PCR primersa

PrimerSequence (5′→3′)
Step 1a
    ForwardACACTGACGACATGGTTCTACA + heterogeneity spacer (0–7 bp) + ACTCCTRCGGGAGGCAGCAG
    ReverseTACGGTAGCAGAGACTTGGTCT + heterogeneity spacer (0–7 bp) + GGACTACHVGGGTWTCTAAT
Step 2bIllumina 3′ flowcell linker + index + CS1/CS2
    ForwardAATGATACGGCGACCACCGAGATCTACAC + index (8 bp) + ACACTGACGACATGGTTCTACA
    ReverseCAAGCAGAAGACGGCATACGAGAT + index (8 bp) + TACGGTAGCAGAGACTTGGTCT
  • a See Data Set S1 for full oligonucleotide sequences. For step 1, primer sequences are presented as Illumina 5′ sequencing primer (CS1/CS2) + heterogeneity spacer + 16S rRNA gene V3-V4 primer.

  • b See Data Set S1 for full forward and reverse oligonucleotides, respectively. For step 2, primer sequences are presented as Illumina 3′ flow cell linker + index + CS1/CS2.