TABLE 3

1-Step PCR primersa

PrimerSequence (5′→3′)
ForwardAATGATACGGCGACCACCGAGATCTACAC + GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT +
index (8 bp) + heterogeneity spacer (0–7 bp) + ACTCCTRCGGGAGGCAGCAG
ReverseCAAGCAGAAGACGGCATACGAGAT + ACACTCTTTCCCTACACGACGCTCTTCCGATCT +
index (8 bp) + heterogeneity spacer (0–7 bp) + GGACTACHVGGGTWTCTAAT
  • a Primer sequences are presented as Illumina MiSeq 3′ flow cell linker + Illumina 5′ sequencing primer (CS1/CS2) + index + heterogeneity spacer + 16S rRNA gene V3-V4 primer.