TABLE 1

Primers used in this study

Primer nameSequence (5′ to 3′)
confirm_marinerGAGCTTAGTACGTACTATC
confirm_04200::TnATGGCGATAGTGGCCCGGTC
confirm_07245::TnGGCGGCGTCGGCAATTTCCTG
confirm_07250::TnGTCGGTGCAGCGCAGGATG
confirm_10885::TnCTGGGTCGAGCATCAGGTGG
Barseq_P1 (5N)AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGTCGACCTGCAGCGTACG
Barseq_P1_2NAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNGTCGACCTGCAGCGTACG
Barseq_P1_3NAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNGTCGACCTGCAGCGTACG
Barseq_P1_4NAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTCGACCTGCAGCGTACG
BarSeq_P2_noindexCAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGATGTCCACGAGGTCTCT
BarSeq_P1_SangerSeqGAGATCTACACTCTTTCCCTACAC
amplify_10885_forwardAACCTCATCAACGAACTGCTCG
amplify_10885_reverseTCAGCTGAAAGTGTGTCGGCTC
amplify_10890_forwardGAATTACGAATCAACCAAAAGGC
amplify_10890_reverseTCAGACGCCCCCCTGCTTG
amplify_07255_forwardCGTATCGAAGTGCTTGTCGA
amplify_07255_reverseCTAGCTGGCGAACCGTCGC
amplify_07245_forwardAGTGTCCTACAACGGCTG
amplify_07245_reverseTTACAGGTACTCGACGTTACC
amplify_pET32_revATGATGATGATGATGGTGCATATGGCC
amplify_pET32_forTCTTCTGGTCTGGTGCCACGCGGTTC