TABLE 2 

Oligonucleotides used in this study

OligonucleotidePurposeSequence
KL12F primer to amplify RK2 oriT from pJC8, with HindIII adapterCCTAAGCTTTCGGTCTTGCCTTGCTCGTCGG
KL13R primer to amplify RK2 oriT from pJC8, with HindIII adapterCCTAAGCTTGCGCTTTTCCGCTGCATAACCC
KL14F primer to amplify ermF-repA fragment from pAFD1, with EcoRI adapterCCTGAATTCACTTTTGTGCAATGTTGAAGATTAGTAATTCTATTC
KL15R primer to amplify ermF-repA fragment from pAFD1, with EcoRI adapterCCTGAATTCATAACAGCCGGTGACAGCCGGC
KL16Primer walking ermF-repA fragmentGTTCAACCAAAGCTGTGTCGTTTTCAATAGC
KL33Primer walking ermF-repA fragmentCAGGTATGCCAAACGTGGTTCTAAAAATGC
KL42Primer walking ermF-repA fragmentGGAACTGCAAAATTCCTAAAATCACAACC
KL43Primer walking ermF-repA fragmentCAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGG
KL45Primer walking ermF-repA fragmentAACAGACAAAGCCGTTTATAAAGGACTTGC
KL46Primer walking ermF-repA fragmentGTCAGCAACAAAGGTAGTACTTTATTATCG
KL61F primer for B. thetaiotaomicron anSME ORF (BT_0238)ATGAAAGCAACAACTTATGCACCTTTTGCCAAACC
KL62R primer for B. thetaiotaomicron anSME ORF (BT_0238)TTAATATTCTATTTTTAAACTTCCGTCTTTTAGTGCTTTC
KL63F primer for 300 bp upstream of B. thetaiotaomicron anSME ORFTCTCCATCCCTCAAAGTCTTCAGATATAACATTTTTCC
KL65R primer for 300 bp downstream of B. thetaiotaomicron anSME ORFTAACCGCAGTGATGGTTAGTCAGGATCAAGC
KL67Sequence anSME PCR product from clone CLGM3_chuR5AAGCGGACGCATCAGCGTTTCTCCACC
KL69Sequence anSME PCR product from clone CLGM3_chuR5TCTATTTGCCTGCAACGGAGAATGTCC