TABLE 2

List of E. coli MG1655 genes used for expression analysis using RT-qPCRa

Serial
no.
Gene
name(s)
Gene functionNCBI
gene ID
5′ primer3′ primerAmplicon
size (bp)
1acpD/azoRThiol stress protection947569GCACTCCGCTGATGAAATGGTGCCGCAATAACGATAA189
2adhEAlcohol dehydrogenation945837GGGTTCCCAGTTCCATATTCGTCGGCAATTTCAGCATAAC154
3asrAcid shock resistance945103TGCTATGGGTCTGTCTTCTGGGCTTTCTGTTCAGCTT188
4csrBCarbon storage regulation2847719CCAGGATGGAGAATGAGAACGCAGCATTCCAGCTACTT190
5dinBAdaptive mutation induction944922CGCCTCCGACATGAATAAGCATCACCAGATCACACTT179
6emrKMultidrug efflux transportation946840TTAAACCGTCAGCCACAAGCGGTACGACAGCCATTAAC168
7fba/fbaAGlycolysis aldol condensation catalyzing947415GCCGGAAGACGTTGATTACCGGCAGGTTGTGTTTCTT172
8fecAFerric citrate uptake for porin formation946427CGTACAGTACAGCCAGATTGGGTTGGAGTCGTACTGATTG158
9fimHReceptor recognition and fimbrial
adhesion
948847CTTATGGCGGCGTGTTATGCTCACAGGCGTCAAATA152
10frdBIron-sulfur fumarate reduction948666GCGAAGTATCACCAGTTCTCGCCATACGCTCCTTCTTAC161
11gcvPGlycine decarboxylation947394GCGCAACAGCAAGAAATGGTAACCCATGCCGATGTAAG198
12glpCAnaerobic glycerol-3-phosphate
dehydrogenation
946735ACCAGGTCGCTTTCTTTCCCTGTTTGCGTGCTTTATC174
13lamBMaltose diffusion facilitation948548ATGCACGTTCCGGTATTGAGCTCTTATCGCCCTCTT156
14lexATranscriptional repression of
SOS regulon
948544CTCATCCGTGATCACATCAGGCAACCCTTCTTCCTCTTC190
15manX2-Deoxyglucose phosphorylation946334CGTGCTGTTTCTCGTTGATATCACGGCCTGTTTCTACT189
16manYMannose PTS permease formation946332GTTTCACCGTCCGCTAATCTCTGATGACCTGCGATAAC189
17manZMannose PTS permease formation946342CTGGTTGTCTCTCGCATTACCGATACCGATGACGAAGAAG181
18mdoG/opgGMembrane-derived oligosaccharide
synthesis
945005GTGGATGTGCAGTCGAAACATTACCGGCATGGATAGAG163
19nmpCOuter membrane porin formation946786ACTACGGCTCCATCGATTACCATCAACCAGACCAAAGAA178
20ogrKBacteriophage P2 late transcription
control
945404CAAGCCGCTATATCACTGACTAATTTGCTGCCCTGACG165
21oxcOxalate-induced acid tolerance response946845CCGGTGACGATCGTTATTTCTGTCGTGGTGACGTTATAG163
22recASOS response regulation947170GGTACAGCTACAAAGGTGAGGCCTTCGCTATCATCTACAG164
23recNRecombination and DNA repair947105CGATCCCAACCGACTATTTGGTGCCTGCTGATGATGTT194
24srlBSorbitol permeation948971CCAGATGCTCATCACCTTTCGTTCGCGAAGGTTGTCTT176
25srlDSorbitol-6-phosphate dehydrogenase948937CCTTTATCAGCGACTTCCAGCTGTAGCCAGAGTTGTGTTT181
26srlESorbitol permeation948933CGTGACTATGACACCAGTAAGCCGAGACGAATGCCATAAA163
27srlRSorbitol repression948942CTGCTCTCGCGCTTTAATGTCGGTGCCCATAAACAA198
28sulAStress-Induced mutagenesis
response promotion
947335TGGGCTACCCTTAACGAAGCTTACCGGACGCATAATAA205
29tdcDPropionate and acetate kinase947635CAGCGTACGGGTTCATTTCACCACTTTACCGTCGATAC159
30tnaAl-Tryptophan cleavage948221CGATATTCCGGTGGTAATGGGCACCATCGCATCTTTCT164
31treCTrehalose-6-phosphate hydrolase948762CCCTGTATTGTGGTGCTATCGTTGTGGTGAGGCTTCTT152
32ybiJPutative motility and biofilm
formation factor
945433CCAGGCACAGAACATGAATACCGCAGTACCGCTTAATTT155
33ydeOAcid shock resistance945922GCGTAGAAGGTTCAGTCAATCATCGTGTTGCCCGTATT211
34yebFOuter membrane porin formation946363CGTTGGGCAGATGATCAAAGCTGATATTCCGCCATTCC178
35yegRHypothetical function946613TCAGCGTAAACTCGATAACCTCCTACACCTTCTGTCTTCA163
36yeiHInner membrane formation946668AAGCGGAAGCCAGTAAAGCACTTCGTGCACAGTAGAA155
37yfdW/frcOxalate-induced acid tolerance946842CGGAAGGCAAAGAGGTAATGAGGCGAACACTCATCAAAC167
38yfdxAcid shock resistance949108ACGATGGTCACAGCAATTCCGTCACGCATCGCATATAA157
39yhaKChlorine binding and oxidative
stress sensing
947620CATATCGTGCTCGACAAAGGGGCAACCAGCGTAATGTT174
40yjiYPutative peptide transporter948914ATGAAGCGCACCCAATACGGTCAGTACCGTTAGCAATC166
41ypdIColonic acid synthesis949107TTTCCATTTCGGGTGGTGGGCATTTCTTCTGTGAGGT157
  • a The ffs gene encoding a 4.5S RNA component of the signal recognition particle (SRP) is missing from this list as its size was a mere 114 bp, which was difficult to incorporate in the current scheme of RT-qPCR methodology. The gene named mdoG (mentioned at serial no. 18 in this table) was used as the reference gene for data analysis purposes using the Livak method (46). ID, identifier; PTS, phosphotransferase system.