TABLE 3 

Predicted clustered regularly interspaced short palindromic repeats in the bacterium Gsub genome

CRISPR IDaAvg length of repeats (bp)Repeat sequenceSpacer sequenceLength of spacer (bp)
CRISPR 134TGTATTGGTTTGAATATCATCAACTGTTGCTGTTGCTGATGCTCGTAAATTATCAATTGCATCGGCATTGGTCGTTATATTGCT50
TGTATTGGTTTGAATATCATCAACTGTTGCTGTTACTGAGGTTTGTAAGGTGTTAATTGCTGTTGTATTGTTTGTAACATTACC50
TGTATTGGTTTGAATATCATCAACTGTTGCTGTT
CRISPR 236GTTGTGATTTGCGTTTAGGCAATAGTCTGTTACAATTTTGGCTATTCCTGGTTTTCTGCTCATTAG30
GTTGTGATTTGCGTTTAGGCAATAGTCTGTTACAATAAAATATATATTCAATAAAAGACAACAAAG30
GTTGTGATTTGCGTTTAGGCAATAGTCTGTTACAATCAGCAAGTTATTCTGCTAAATACATCACTG30
GTTGTGATTTGCGTTTAGGCAATAGTCTGTTACAATTTAGTATCATTTTTTACCCCCTTGTTTAAA30
GTTGTGATTTGCGTTTAGGCAATAGTCTGTTACAAT
CRISPR 336ATTGTAACAGACTATTGCCTAAACGCAAATCACAACAATGGTAGCAATGCTATTAGTTTTACAGAT30
ATTGTAACAGACTATTGCCTAATCGCAAATCACAACAAACTCACAAGGGTTAGTGATTATCGTCTT30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACTTAACTCCTTAAAGGTGCGAATATGTATAG30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACGCCTCAATTAAGCACACGGCAGGCCTACTC30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACACAAAATTAGGCAAAGTATGAAAGAAAAA29
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACCACCTTACGAATTGCTTGTTGCCAAACAA29
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACTGTACAGTGCTTTTTCTGTTTCACGAATGA30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACCGAATGATTTTCATTTTGTTGTCTCCTTTA30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACCGAATGATTTTCATTTTGTTGTCTCCTTTA30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAACTAATATACTTAGCTGAATAGCTCGCTGTTA30
ATTGTAACAGACTATTGCCTAAACGCAAATCACAAC
  • a Clustered regularly interspaced palindromic repeats (CRISPR) identification (ID).